CleanCap® Stock mRNAs

Description

Reporter Gene mRNAs

Reporter genes are commonplace tools in cell biology research. TriLink has developed optimized capped (Cap 0 and Cap 1) and polyadenylated mRNA expressing reporters. These reporter mRNAs can be used as controls to study mRNA transfection and expression in mammalian cells using a variety of assays including fluorescence microscopy, quantitative fluorometry and bioluminescent imaging, as well as fluorescence-activated cell sorting (FACS).

Click Product to View Specifications

Gene Replacement mRNA

Many genetic disorders are recessive. In many cases, gene replacement has potential to ameliorate recessive disorders by replacing the defective protein. Historically, DNA based non-viral and viral vector based approaches have been used for gene replacement. However, concerns about insertional mutagenesis have been raised about these approaches.

More recently, mRNA transfection has gained popularity for several reasons. First, with mRNA transfection, there is no risk of insertional mutagenesis. Second, in contrast to plasmid and viral vector based approaches which must reach the nucleus before gene expression, mRNAs only need to cross one membrane to be expressed in the cytoplasm. This may reduce the delivery hurdles that must be overcome before gene replacement can become a reality in the clinic.

Click Product to View Specifications:  CleanCap Erythropoietin (EPO) mRNA (5moU)

Antigen mRNAs for Vaccines and Immunotherapy

mRNA offers several advantages over traditional plasmid and viral-based approaches:

• mRNA boasts a superior safety profile. As a transient carrier of genetic information, it is metabolized naturally and poses little to no risk of genomic integration. Additionally, no inactivated viruses or pathogens are needed.
• mRNA serves the dual purpose of expressing the desired antigen as well as acting as an adjuvant.
• mRNA triggers a more diverse immune response. Because the mRNA encoded epitopes are intracellular, they are recognized by the immune system in an MHC class-independent manner.
• mRNA can more readily transfect difficult-to-transfect cell types because it functions in the cytoplasm. DNA vaccines can be limited by lack of access to the nucleus.
• mRNA manufacturing is easily scalable. Because mRNA transcription is carried out completelyin vitro, to hundreds of millions of vaccine doses with a lead time of as little as a few weeks. This allows for rapid deployment of a new antigen during pandemics.
• mRNA is easily customizable. The ease of manufacturing makes it a viable option for personalized treatments.

Click Product to View Specifications:  CleanCap OVA mRNA     CleanCap OVA mRNA (5moU)

Recombinase mRNA

Site specific recombinases are useful tools for manipulation of genomes and for conditionally activating or de-activating gene expression in cells and organisms. Recombinases recognize short target DNA sequences of approximately 30-40 nucleotides and catalyze directional DNA exchange reactions. These exchange reactions fall into four categories: excisions/insertions, inversions, translocations and cassette exchanges. Because the recognition sites are not commonly found in the genomes of higher organisms, they can be used as tools to engineer genomes. However, continued expression of a recombinase in a cell or in vivo can result in toxicity and undesired off-target recombination. For this reason, transient expression from mRNA is an ideal method for recombinase expression.

Our CleanCap NLS-Cre Recombinase mRNA is a capped (Cap 1) and polyadenylated messenger RNA encoding Cre recombinase fused to a nuclear localization sequence (NLS). Cre recombinase is a tyrosine recombinase derived from the P1 bacteriophage. Cre catalyzes recombination between two loxP sites which consist of a 34 base pair recognition site (5′ ATAACTTCGTATAGCATACATTATACGAAGTTAT 3′).

Click Product to View Specifications: CleanCap^® NLS-Cre Recombinase mRNA (5-methoxyuridine)